Skip to content

nkvamaks/oligoshell_calc

Folders and files

NameName
Last commit message
Last commit date

Latest commit

 

History

30 Commits
 
 
 
 
 
 
 
 
 
 
 
 
 
 

Repository files navigation

About OligoShell Calculator:

OligoShell Calculator is a comprehensive web application designed for calculating various properties of natural (DNA, RNA), modified, and therapeutic oligonucleotides. Our tool offers advanced features that meet the needs of researchers and professionals in the fields of nucleic acid chemistry and molecular biology.

Key Features:

  • NEW! Calculate melting temperatures of MGB-modified oligonucleotide probes, similar to Primer Express 3.0 software.
  • Determine melting temperatures of DNA oligonucleotides with DNA targets.
  • Compute extinction coefficients using nearest neighbors model.
  • Obtain monoisotopic and average molecular weights and charge states.
  • Generate molecular formulas for oligonucleotides.
  • Predict theoretical masses of fragments in MS/MS experiments.
  • Quantify oligonucleotides based on user input of measured absorbance at 260 nm and volume of the oligonucleotide solution.

New Tool: TaqMan Finder

This tool simplifies the process of finding matching primers and probes for TaqMan assays within your specified target sequence. By providing the exact (single isotope) masses of both primers and the probe, chemical modifications of the probe, length of the amplicon, and the reference sequence (RefSeq), you can easily identify compatible components for your assay.

Sequence Input Guidelines:

Sequences must be entered from 5' to 3'. You can choose whether your oligonucleotide is primarily DNA, RNA, or Therapeutic. For sequences containing phosphorothioate linkages, use an asterisk (*) as a separator.

  • DNA / RNA Input

    Use single-letter codes for standard nucleotides (A, C, G, T/U) and degenerate nucleotides (W, S, M, K, R, Y, B, D, H, V, N). These single-letter codes represent deoxy-nucleotides for DNA and ribo-nucleotides for RNA. For other nucleotides or modifications, use their designated multi-letter codes enclosed in square brackets, e.g., [+Cm], [FAM], or [GALNAC-PRO].

  • Therapeutic Input

    Enter each nucleotide, degenerate nucleotide, or modification using its specific designation. Separate each entity (nucleotide, modification, or phosphate backbone) with a space.

  • To facilitate input, use dropdown menus with modifications of nucleotides from the 'keyboard'.

Examples:

  • DNA: ACGTACGTGGCAGGCA
  • DNA: [VIC]CCGGCGCGNTTSCGTC[MGB-ECLIPSE]
  • RNA: [po]ACGUGGCUSGACUGVUUGAUNG
  • RNA: GUGCGAAGGGACGGUGCGGAGAGGAGAGCAC[GALNAC3-ALN]
  • Therapeutic: +A +Cm +G dT dA dC dG dT dG dG dC dA dG +G +Cm +A
  • Therapeutic: +Cm * +G * +T * dA * dA * dC * dC * dT * dG * dA * dC * dC * dG * +A * +G * +A

Available Nucleotides:

  • Deoxynucleotides: dA, dC, dG, dT, dU, dCm
  • Degenerate deoxinucleotides: dW, dS, dM, dK, dR, dY, dB, dD, dH, dV, dN
  • Ribonucleotides: rA, rC, rG, rU
  • Degenerate ribonucleotides: rW, rS, rM, rK, rR, rY, rB, rD, rH, rV, rN
  • 2'-OMe nucleotides: mA, mC, mG, mU
  • 2'-F nucleotides: fA, fC, fG, fU
  • 2'-MOE nucleotides: moeA, moeCm, moeG, moeT
  • LNA nucleotides: +A, +Cm, +G, +T
  • * Cm stands for 5-methylcytosine and T for 5-methyluracil

Experience full functionality of the OligoShell Calculator online at www.oligoshell.com