Skip to content

Files

Latest commit

cd6dec1 · Dec 26, 2023

History

History
98 lines (73 loc) · 3.47 KB

README.md

File metadata and controls

98 lines (73 loc) · 3.47 KB

isPCR: in silico PCR

Description

The core component of the isPCR pipeline is thermonucleotideBLAST developed by Gans et al. In silico PCR involves oligonucleotides as queries to search for gap alignments that are bounded by foward and reverse primers. qPCR Taqman probe sequences can be provided as an additional factor to parameterize the search. Sequence matches are defined by thermodynamic properties such as hybridization melting temperature (Tm), and Gibb's Free Energy (deltaG). More information on the implementation of the algorithm can be found here.

The isPCR pipeline wraps thermonucleotideBLAST in Nextflow framework to allow in silico PCR to be scalable, flexible, and parsable. Sequence search against FASTA and FASTQ formats is supported. thermonucleotideBLAST outputs are further processed to report alignment results in standardized formats (BED/FASTA/TSV).

Installation

# Install pre-requisites
 - Nextflow >= 21.0
 - Docker or Singularity
 - Git

# Pull the latest pipeline code from GitHub
nextflow pull jimmyliu1326/isPCR

Getting Started

Preparing samples.csv

Paths to database sequences must be supplied in the form of a headerless samples.csv with two columns that encode database IDs and paths to DIRECTORIES containing .FASTA or .FASTQ files (gzipped files are supported). Each database can be a set of genome assemblies, genes or raw reads.

Example samples.csv

Sample_1,/path/to/data/Sample_1/
Sample_2,/path/to/data/Sample_2/
Sample_3,/path/to/data/Sample_3/

Given the samples.csv above, your data directory should be set up like the following:

/path/to/data/
├── Sample_1
│   └── Sample_1.fastq.gz
├── Sample_2
│   └── Sample_2.fastq.gz
└── Sample_3
    ├── Sample_3a.fastq
    └── Sample_3b.fastq

Note:

  • The sequencing data for each database must be placed within a unique subdirectory
  • The names of the database subdirectories do not have to match the IDs in the samples.csv
  • You can have multiple .FASTQ or .FASTA files associated with a single database. The pipeline will aggregate all .FASTQ/.FASTA files within the same directory before proceeding.

Preparing primers.txt

Primer sequences have to be formatted in a headerless space delimited file containing 3 columns and an optional 4th column.

  • Column 1: Primer ID (do not include blank spaces!)
  • Column 2: Forward primer sequence
  • Column 3: Reverse primer sequence
  • Column 4 (optional): Probe sequence

Example primers.txt

TetH CAGTGAAAATTCACTGGCAAC ATCCAAAGTGTGGTTGAGAAT
TetR GATATAAAAAAACATTCTTA ATTGATCCTAAAACTGGACT

Pipeline Usage

The pipeline executes process in Docker containers by default. Singularity containers and management of pipeline processes by Slurm are also supported. See below for simple use cases demonstrating pipeline execution using different preconfigured profiles.

Docker (Default)

nextflow run jimmyliu1326/isPCR -latest \
    --input samples.csv \
    --primer primers.txt \
    --input_format fasta

Singularity

nextflow run jimmyliu1326/isPCR -latest \
    --input samples.csv \
    --primer primers.txt \
    --input_format fasta \
    -profile singularity

Singularity + Slurm

nextflow run jimmyliu1326/isPCR -latest \
    --input samples.csv \
    --primer primers.txt \
    --input_format fasta \
    -profile singularity,slurm