From 712c622dd801f8a15858afd84de7b2aa4f70e2a3 Mon Sep 17 00:00:00 2001 From: Rad Suchecki Date: Fri, 22 Nov 2019 16:50:04 +1030 Subject: [PATCH] catchup (#54) * bug fix * params not captured in meta * timestamp in results release tag * date in release tag, release body update * removed beers remnants * release body update * iso date/time in release tag * release body formatting * tidy-up release * update * updated docu * added --subset option * cleanup --- bin/add_adapter2fasta_V3.pl | 139 ------------------------------------ 1 file changed, 139 deletions(-) delete mode 100755 bin/add_adapter2fasta_V3.pl diff --git a/bin/add_adapter2fasta_V3.pl b/bin/add_adapter2fasta_V3.pl deleted file mode 100755 index 546a97c..0000000 --- a/bin/add_adapter2fasta_V3.pl +++ /dev/null @@ -1,139 +0,0 @@ -#!/usr/bin/env perl - -# Script to add retained adapter tails into read sequences. -# 75% of all reads will have retained adapters with lengths ranging from 1 to a maximum of 30bp -# These retained adaptors will be inserted into the read sequence at the 5' end with the read 3' trimmed back to it's original length -# The actual length of retained adapters will be randomly chosen with 50% in length range 1bp to 5bp, 25% in length range 6bp to 10bp, 12.5% in length range 11bp to 15bp, and remander 16bp to 30bp -# Will be using the Illumina Universal Adapter as the retained adaptor template sequence -# Usage: -# add_adapter2fasta_V3.pl read_forward.fa read_reverse.fa read_forward_adapters.fa read_reverse_adapters.fa - -# Illumina Universal Adapter -$adapter = "AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT"; -chomp($adapter); -$adapter = uc($adapter); - -# reverse complement of the adapter sequence (for reverse reads) -$adapter_rev = reversecomplement($adapter); - -# for reproducabilty always explicity seed the random number generator -srand(int(5637)); # haven't given much thought to this seed, it's a prime so should be good enough for this application! - -$forward_out = $ARGV[2]; -$reverse_out = $ARGV[3]; -open(FORWARD, ">$forward_out"); - -open(INFILE, $ARGV[0]); # the forward reads fasta file -$flag = 0; -$count = 0; -while($line = ) { - if($flag == 0) { - print FORWARD $line; - $flag = 1; - next; - } - chomp($line); - $line = uc($line); - $SeqLen=length($line); - $flag = 0; - $RetainLen=int(rand(4)); # 75% of reads to contain at least 1bp of retained adapter - if($RetainLen > 0) { # > 0 if read to have retained adapter - $RetainLen=int(rand(10))+1; # 50% of reads with retained adapters to retain 1..5bp - if($RetainLen > 5) { - $RetainLen = int(rand(10))+6; # 25% of reads with retained adapters to retain 6..10bp - if($RetainLen > 10) { - $RetainLen = int(rand(11))+11; # 12.5% of reads with retained adapters to retain 11..15bp - if($RetainLen > 15) { - $RetainLen = int(rand(15) + 16); # remainder (12.5%) to retain 16..30bp - } - } - - } - $line = substr($adapter,-1 * $RetainLen) . substr($line,0,$SeqLen-$RetainLen); - } - print FORWARD "$line\n"; - $count++; - } -close(INFILE); -close(FORWARD); - -open(REVERSE, ">$reverse_out"); -open(INFILE, $ARGV[1]); # the reverse reads fa file -$flag = 0; -$count = 0; -while($line = ) { - if($flag == 0) { - print REVERSE $line; - $flag = 1; - next; - } - chomp($line); - $line = uc($line); - $SeqLen=length($line); - $flag = 0; - $RetainLen=int(rand(4)); # 75% of reads to contain at least 1bp of retained adapter - if($RetainLen > 0) { # > 0 if read to have retained adapter - $RetainLen=int(rand(10))+1; # 50% of reads with retained adapters to retain 1..5bp - if($RetainLen > 5) { - $RetainLen = int(rand(10))+6; # 25% of reads with retained adapters to retain 6..10bp - if($RetainLen > 10) { - $RetainLen = int(rand(11))+11; # 12.5% of reads with retained adapters to retain 11..15bp - if($RetainLen > 15) { - $RetainLen = int(rand(15) + 16); # remainder (12.5%) to retain 16..30bp - } - } - - } - $line = substr($adapter_rev,-1 * $RetainLen) . substr($line,0,$SeqLen-$RetainLen); - } - print REVERSE "$line\n"; - $count++; - } - - -sub getrandbase () { - $x = int(rand(4)); - if($x == 0) { - return "A"; - } - if($x == 1) { - return "C"; - } - if($x == 2) { - return "G"; - } - if($x == 3) { - return "T"; - } -} - -sub reversecomplement () { - ($sq) = @_; - @A = split(//,$sq); - $rev = ""; - for($i=@A-1; $i>=0; $i--) { - $flag = 0; - if($A[$i] eq 'A') { - $rev = $rev . "T"; - $flag = 1; - } - if($A[$i] eq 'T') { - $rev = $rev . "A"; - $flag = 1; - } - if($A[$i] eq 'C') { - $rev = $rev . "G"; - $flag = 1; - } - if($A[$i] eq 'G') { - $rev = $rev . "C"; - $flag = 1; - } - if($flag == 0) { - $rev = $rev . $A[$i]; - } - } - - return $rev; -} -