EGB25

Design of the pTAx cloning vectors

Background

In the mec research group, we are interested in understanding and engineering the biosynthesis of fatty acids and related products by the unicellular fungi known as baker's yeast Saccharomyces cerevisiae.

Genetic engineering of complex traits require the simultaneous deletion and/or expression of multiple genes. This is a challenging problem as genetic engineering is time consuming. To solve this problem, we developed a protocol for the assembly of metabolic pathways that we call the Yeast Pathway Kit (see our publication in ACS Synthetic Biology).

We use this protocol for construction and expression of large metabolic pathways in baker's yeast Saccharomyces cerevisiae such as this heterologous fatty acid synthesis pathway.

The first part of the protocol is assembling a single gene expression cassette or Transcriptional Unit, TU. A TU consists of a single gene are cloned between a promoter and a terminator by in-vivo homologous recombination as in Figure 1 below.

Figure 1

The promoter, gene and terminator are typically PCR products while the long, curved fragment is a linearized plasmid. This plasmid is important since it provides elements for replication and selection in both E. coli and S. cerevisiae. The first plasmid we used for this purpose was called pYPKpw and it has the following functional parts (Table#1):

Table#1, pYPKpw	part	function
	ampR	selection marker for E. coli
	pUC	origin of replication for E. coli
	2µ	multicopy origin of replication for S. cerevisiae from the natural 2µ plasmid
	URA3	selection marker for for S. cerevisiae
	Δcrp	a partial, inactive E. coli cyclic AMP receptor protein or CRP gene

The Δcrp gene is inactive and only provide a recombination site. The pathways that we make are ment for Saccharomyces cerevisiae, but we often need to transfer the pathway to E. coli so we can obtain larger amounts of higher quality DNA for analysis or transformation.

The pUC origin of replication (ORI) results in a high copy number of the vector in E. coli which is an advantage. However, we have observed genetic instability in E coli for some large pathways that we suspect is linked to high copy number. Our experience is that a lower copy number provides more stability.

pTAx vectors

We conceived a series of plasmid vectors called pTAx where x is a number from 1 to 11 (at the moment). The pTAx vectors were designed to have a lower copy number in E. coli to try to solve the stability problems of pYPKpw. The pTAx plasmids should have a lower copy number in E. coli than the pUC based pYPKpw since they have the pBR origin of replication that includes the ROP gene.

The pTAx vectors are made from five elements (Table #2).

Each element is a distinct segment from a particular source plasmid. The pTAx vectors are similar to each other, but differ in the selection markers (yeast marker) and yeast origin of replication (yeast ORI).

We assemble pTA plasmids from five PCR products, see (pTAx assembly strategy).

Table#2	Name	E. coli marker	E. coli ORI	yeast ORI	yeast marker	MCS	Constructed by:	Enzyme to linearize	🥶 freezer list number(s)	Sequenced?	Date
	pTA1	ampR	pBR	2µ	LEU2	ΔCRP	Tatiana Pozdniakova	AatII, ZraI, FspAI	µ828, µ928, µ929	✅	2019-10-xx
	pTA2	-"-	-"-	CEN/ARS	LEU2	-"-	EGB2023	AatII, ZraI, FspAI	µ1814, µ1815, µ1817		2023-06-01
	pTA3	-"-	-"-	2µ	HIS3	-"-	Tatiana Pozdniakova	AatII, ZraI, FspAI, EcoRV	µ1271		2021-07-09
	pTA4	-"-	-"-	CEN/ARS	HIS3	-"-	EGB2023	AatII, ZraI, FspAI, EcoRV	µ1816, µ1818, µ1819		2023-06-01
	pTA5	-"-	-"-	2µ	KanMX4	-"-	Paulo Silva, Julio Freire	AatII, ZraI, FspAI, EcoRV	µ1652	✅
	pTA6	-"-	-"-	CEN/ARS	KanMX4	-"-	GMB20	AatII, ZraI, FspAI, EcoRV	µ520		2020-12-23
🔥	pTA7	-"-	-"-	2µ	TRP1	-"-	EGB2025 ❓	AatII, ZraI, FspAI	❓	❓	❓
	pTA8	-"-	-"-	CEN/ARS	TRP1	-"-	GMB20	AatII, ZraI, FspAI	µ521, µ522		2020-12-23
	pTA9	-"-	-"-	2µ	URA3	-"-	Tatiana Pozdniakova	AatII, ZraI, FspAI	µ1272		2021-07-09
	pTA10	-"-	-"-	CEN/ARS	URA3	-"-	GMB20	AatII, ZraI, FspAI	µ523		2020-12-23
	pTA11	-"-	-"-	2µ	LEU2d	-"-	EGB2024	AatII, ZraI, FspAI	µ542	✅	2024-05-23

During the 2025 lab course, we will try to make the last plasmid in the table that was not yet made: pTA7.

The lab course is divided into nine practical classes. Each student attends three of the nine classes.

LAB				Task
1️⃣	PL1			Prepare plasmid DNA from plasmids (miniprep)
2️⃣		PL2		Analyze plasmid DNA by agarose gel ➕ Prepare PCR reactions for each plasmid element
3️⃣			PL3	Analyze PCR products by agarose gel ➕ Inoculate S. cerevisiae for transformation
4️⃣	PL1			S. cerevisiae transformation
5️⃣		PL2		In-silico assembly of plasmid 💻
6️⃣			PL3	S. cerevisiae colony PCR
7️⃣	PL1			Analyze Colony PCR products by agarose gel
8️⃣		PL2		Plasmid rescue to E. coli (Yeast DNA preparation ➕ E. coli transformation)
9️⃣			PL3	Plasmid alkaline lysis miniprep with commercial kit.

Photo contest

Take pictures during class! This helps remembering what you did and how. You can upload your pictures to this shared Google album. Use the link in Blackboard.

We will have a photo contest within each PL and we will also select the best image overall. This means that there will bu up to four winners, one for each PL and one overall. Mark you image with your name, number and PL in the Google photo album.

LAB 1️⃣ PL1 Miniprep#1

material#LAB1

Summary:

• Plasmid miniprep using alkaline lysis

Miniprep

We will prepare four plasmids using alkaline lysis mini prep (see Table#3). The last column states why we need each particular plasmid.

Table#3	Group	Plasmid	Source for:
	1	pBR322	amp & pBR
	2	pYPKpw	Δcrp
	3	YIplac204	TRP1
	4	YEplac195	2µ

We will use a homemade alkaline lysis plasmid miniprep protocol. Here is a short protocol for printing.

The teacher has prepared E. coli cultures in liquid or on solid medium beforehand.

Cultures with each plasmid were grown in or on LB with ampicillin for selection of the plasmids. These videos show basically the same protocol.

LAB 2️⃣ PL3 Gel#1 ➕ PCR#1

material#LAB2

Summary:

• gel#1 on plasmid DNA.
• Plasmid DNA dilution.
• Preparation of a PCR reaction.
• Make liquid YPD medium for LAB3.
• Make solid SD medium for LAB4.

Agarose gel electrophoresis of plasmid DNA

1. Unfreeze the plasmids from LAB1
2. Vortex the tube to mix the content. If necessary, spin the tube for ~2-3 seconds to collect the liquid at the bottom.
3. Take out 10 µL of the content to a fresh tube.
4. Add 2 µL 6 x loading buffer to your plasmid DNA.
5. Put the gel in the gel tray in a square petri dish. The gel should have at least one well per group number and one extra for the marker.
6. Add 5 µL of the plasmid DNA to an empty well, start with the leftmost well.
7. All group members should load their plasmid.
8. Take note of where your samples are.
9. The teacher will help you to put the gel in the electrophoresis chamber.
10. The teacher will load the molecular weight marker.
11. Apply the electrical field as soon as you are done.
12. The electrophoresis last around ⌛15 min at ⚡200 volts in the Bachman gel tank using a homemade rectifier.
13. When the gel run is completed, the teacher with take a picture using a transilluminator.

Post stain (The instructor does this)

• Put the gel in TAE + Midori Green, incubate 15-30 min
• Take picture

Dilution of plasmid DNA

14. Pipette 1 mL (1000 µL) ultra-pure water into a clean 1.5 mL Eppendorf tube
15. Mark this tube well so that you can identify it.
16. Transfer 5 µL of the plasmid DNA to the tube with 1 mL water This will make a 5 µL/1000 µL = x 200 dilution.
17. Vortex the tube with the x 200 plasmid dilution so that the content is well mixed.
18. Put the tube with concentrated plasmid DNA back into the freezer.
19. Leave the tube with your diluted plasmid DNA on the bench and continue with the next step.

Preparation of a PCR reaction

Each student should prepare one PCR reaction. Add the reagents in the order given below in a 200 µL PCR tube. Pipette very carefully, there is only a limited amount of reagent which is expensive.

PCR amplification (50 µL):

• 33 µL 1.66 x PCR mastermix (= 2xPCR mastermix with 6x loading buffer , hhis is a green solution that has both PCR master mix and loading buffer)
• 5 µL primer 1 (5 µM, check the google sheet for your PCR reaction)
• 5 µL primer 2 "
• 7 µL of the x 200 diluted plasmid DNA.

Table#4	PCR template for	Primer1	Primer2	Template
	amp	1113	987	pBR322
	pBR	1196	1195	pBR322
	Δcrp	978	977	pYPKpw
	2µ	984	983	YEplac195
	TRP1	1804	1347	YIplac204

See see pTAx assembly strategy

Run PCR#1

The teacher will take the tubes to the BioRad T100 thermal cycler of the LGM laboratory:

Liquid YPD medium for LAB3

Each group should make 100 mL liquid YPD medium in a 250 mL Schott flask. Put a small piece of autoclave tape on the lid. Label the flask properly (Content, Date, Course, Turno, Group etc.).

LAB 3️⃣ PL2 Gel#2 ➕ Yeast culture

material#LAB3

Summary:

• Analyze PCR products from LAB2 on gel#2
• Inoculate S. cerevisiae in liquid YPD cultures with from LAB2

Agarose gel electrophoresis of PCR product DNA (gel#2)

It is critical that you keep track of your PCR tube. They are very small and have only a number written on them. We need them for the transformation later, so we can not lose them.

1. Put the gel in the gel tray in a square petri dish. The gel should have at least one well per group number and one extra for the marker.
2. Add 5 µL of the PCR product DNA to an empty well, start with the leftmost well.
3. All group members should load their PCR product.
4. Take note of where your PCR product is.
5. The teacher will help you to put the gel in the electrophoresis chamber.
6. The teacher will then load the molecular weight marker.
7. Apply the electrical field as soon as you are done.
8. The electrophoresis last around 15 min at 200 volts in the Bachman gel tank using a homemade rectifier.
9. When the gel run is completed, the teacher with take a picture using a transilluminator.

Inoculate yeast culture (one per group)

The first task is to measure the optical density of the culture. We do this by diluting the culture ten times in the same medium and measuring the OD640 nm against the medium as blank.

1. Add some YPD medium to a plastic weighing boat. This medium does not need to be sterile.
2. Add 900 µL YPD from the weighing boat to a cuvette.
3. Mix cell culture and add 100 µL to the cuvette.
4. Measure OD640 with a spectrophotometer.
5. Calculate the optical density of the culture.
6. Calculate the volume of cells from the pre-culture that needs to be added to 40 mL of YPD medium to attain an OD640 = 0.17 (OD640 = 0.17 = 5 x 106 cells/ml using a spectrophotometer GENESYS20.)

We can calculate the culture volume we need to add by the equation below:

$OD640 \cdot Va = 0.17 \cdot (40 + Va)$

• OD640 is the optical density calculated for the culture.
• Va is the volume we should add to the culture (mL).
• The culture volume before inoculating is 40 mL.
• The final optical density we want is 0.17.

If we rearrange the equation with $Va$ isolated on the left side, we get: $Va = \frac{6.80}{OD640 - 0.17}$

1. Wipe down the bench with ethanol and light the lamp to create a sterile environment.
2. Add 40 mL of YPD medium to a 50 mL FALCON tube.
3. Add $Va$ mL of pre-culture to your tube.
4. Mix and measure the OD640 by removing one mL to an empty cuvette
5. If the OD640 is ok, pour all the contents of the tube into a sterile Erlenmeyer flask.
6. Incubate until cells have grown for two generations i.e. final OD640 should be 0.17 * 2 * 2 = 0.68
7. Pour the cells into a sterile 50 mL FALCON tube and store on ice.

Solid SD medium for LAB4

Each group should make 500 mL solid SD medium in a 1 L Schott flask. Put a small piece of autoclave tape on the lid. Label the flask properly, (Content, Date, Course, Turno, Group etc.).

LAB 4️⃣ PL1Yeast transformation

material#LAB4

Summary:

• Wash competent yeast cells
• Preparation of DNA mixture
• Yeast transformation
• Plate transformants on solid SD medium from LAB3

Wash competent yeast cells (One per group)

42. Decant the supernatant slowly without disturbing the cells.
43. Pour the content of the yeast culture into a 1.5 mL Eppendorf tube
44. Spin for 20 s in a micro-centrifuge at top speed
45. Remove supernatant by decanting (pipette not needed).
46. Add 1 mL ultra pure water.
47. Resuspend cells by pipetting slowly with a P1000 pipette (slowly, don't make froth).
48. Spin for 20 s in a micro-centrifuge at top speed
49. Remove supernatant by decanting (pipette not needed).
50. Add 800 µL ultra pure water.
51. Resuspend cells by pipetting slowly with a P1000 pipette (slowly!).
52. Put the tube on ice.

Preparation of DNA mixture (One per class)

We need two mixtures, one complete that we call "➕" and one that lacks the pBR fragment that we call "🔺" (delta)", see Table #5. The ∆ mix is a negative control where we would expect few transformants. The plan is for 12 students to transform with the "➕" mix and 4 students with the "🔺" mix.

53. Pool all successful PCR products together except the tubes with the pBR fragment.
54. Measure the volume using a pipette ( for example 380 µL)
55. Divide the mixture 3/4 (➕) and 1/4 (🔺) (285 µL and 95 µL)
56. Add the pBR fragment to the ➕ mix (70 µL)
57. Add an equal portion of water to the 🔺 mix (70/3 = 23 µL)
58. Add 500 µL water to the ➕ mix (to have enough volume for 12 x 60 µL)
59. Add 167 µL water to the 🔺 mix (to have enough volume for 4 x 60 µL)
60. Mix by vortexing.
61. Divide ➕ mix into 3 tubes, 285 µL in each (one for each group).

Table#5	PCR product	➕ mix (12 student)	🔺 mix (4 students)
	amp	✅	✅
	2µ	✅	✅
	TRP1	✅	✅
	ΔCRP	✅	✅
	pBR	✅	❌
	ddH2O	❌	✅

Yeast transformation (One per student)

Each student should make one transformation. This protocol is described in detail here.

62. Mix washed cells by inverting the tube.
63. Transfer 100 µL of the cell suspension to a clean 1.5 mL Eppendorf tube per group member (If the group has four members, you need four tubes.). Mark the tubes.
64. Centrifuge the cells for 20s at the highest speed.
65. Remove supernatant with a P200 pipette. Leave the cell pellet at the bottom of the tube, do not resuspend.
66. Add 60 µL of ➕ or 🔺 DNA mix to the tube with cells.
67. Add 300 µL PLS (PEG-LiAc-ssDNA). Be careful and pipette slowly as PLS is sticky. Use a P1000 pipette with blue tip.
68. Vortex the tubes until cells are well resuspended and no clumps visible.
69. Put the tubes in a floating tube rack at 42°C.
70. Incubate for 40 min.
71. Mark a Petri dish with the appropriate solid medium with your group number and name. Write on the back side, not on the lid.
72. Add about 1/2 mL glass spheres (~10-15 spheres) to the Petri dish.
73. Time for ☕ break.
74. Remove tube from water bath after 40 min and put tube on ice for at least 2 min.
75. Spin tube for 20s at highest speed.
76. Remove supernatant with a P200 pipette. Leave the cell pellet at the bottom of the tube.
77. Add 300 µL YPD medium and resuspend with the pipette by slowly pipetting up and down. Be careful as the cells are sensitive
78. Transfer 100 µL of the cell suspension to your Petri dish.
79. Spread the cells by shaking the glass spheres (The samba method).
80. Give the rest of the cell suspension to the instructor
81. Incubate the plates upside down for 2-4 days at 30°C.

LAB 5️⃣ PL3 In-silico assembly of plasmid

In-Silico PCR simulation

The objective of this task is to simulate each of the five PCR product used to make the vector.

82. The template plasmids that you used can be found in Table#3 above.
83. The template sequences are available through links in Table 1.
84. The primer numbers can be found in Table 2
85. The primer sequences can be found in Table 3.
86. Use WebPCR to simulate your PCR products.
87. Add the size and cdseguid to the pTA7 sheet in the Course Google Sheet

In-Silico Assembly

88. Use the Assembly simulator to join the sequences
89. Add your sequence to the Google sheet
90. Annotate your sequence with pLannotate

LAB 6️⃣ PL2 Colony pcr

material#LAB5

Summary:

• Colony PCR on yeast transformants

Colony PCR (One per student)

Each student should have a plate with colonies. Do not contaminate this plate before you need the cells.

91. Watch this YouTube video (2 min) describing the technique.
92. Add 20 µL 20 mM NaOH to a clean Eppendorf tube.
93. Pick a small amount of cells from your plate with a yellow tip. It is important not to take too much and no agarose (see at 52 s in the video).
94. Add the cells to the solution and swirl to mix (see at 59 s in the video).
95. Incubate tubes at 95°C for ten minutes. While you wait, continue to the next step.
96. Add 20 µL of PCR mix to a new PCR tube.
97. Put the PCR tube on ice (put a dot on the lid with a marker so you do not lose the tube in the ice).
98. When the 95°C incubation is over, add 160 µL TE buffer x 0.5 to the Eppendorf tube with cells.
99. Vortex the tube with cells for 30s.
100. Spin at max speed in a micro-centrifuge.
101. Add 13 µL of the supernatant to the PCR tube.
102. Put tubes in PCR machine (or freeze the tubes at -20°C for later).
103. Run this PCR program:

Taq DNA pol
|95°C  |95°C               |    |tmf:54.8
|______|_____          72°C|72°C|tmr:52.8
|10min |30s  \ 53.8°C _____|____|45s/kb
|      |      \______/ 0:30|5min|GC 42%
|      |          30s      |    |386bp

The PCR mix contains these two PCR primers:

>1222_2954fw 29-mer
GAAATTTCAGCCACTTCACAGGCGGTTTT

>1779_pUCmu_bb_R 24-mer
actcttcctttttcaatattattg

LAB 7️⃣ PL1 Gel#3

material#LAB6

Summary:

• Load gel#3 with colony PCR products from LAB5
• Inoculate 1 mL yeast cultures for plasmid rescue from liquid medium.
• Prepare solid LB Lennox medium with ampicillin medium for LAB7

Gel#3 gel on colony pcr products (One per group)

104. Add 7µL of DNA loading buffer to the PCR tube and vortex.
105. Load 6µL of the the mixture on an agarose gel.
106. Run the gel for 15 min in the using the rectifier in the Bachman electrophoresis apparatus with TAE buffer.

While the gel is running, each group should prepare 250 mL solid LB Lennox medium in a 500 mL Schott bottle.

Inoculate 1 mL YPD medium in a 2 mL Eppendorf tube from the yeast plate. This culture is for plasmid rescue next week.

LAB 8️⃣ PL3 Yeast DNA preparation ➕ E. coli transformation

material#LAB7

Summary:

• Prepare crude yeast DNA from cells with glass beads and an E. coli plasmid miniprep kif
• Transform E. coli with crude yeast DNA
• Plate E. coli on Petri dishes with solid LB-amp medium from LAB6

Plasmid preparation from S. cerevisiae, one per group

107. Yeast cells from selective medium plates ~10 mL YPD were cultured o/n in 50 mL FALCON tubes.
108. Pour two mL of yeast culture into a 2 mL Eppendorf tube.
109. Spin for 20 s in a microcentrifuge.
110. Remove supernatant by decanting.
111. Add the amount of resuspension solution to the cells indicated by the kit (For example NZYMiniprep.).
112. Add 200 µl of glass or zirconium beads (about one full 0.2 mL PCR tube).
113. Resuspend cells by vortexing briefly.
114. Vortex the tubes for 5 minutes using a disruptor genie.
115. Add the lysis buffer as soon as possible, the disruption of the cells liberate nucleases that can damage the DNA.
116. Follow the rest of the alkaline lysis mini-prep kit protocol. For example NZYMiniprep.
117. If the kit has an optional wash step to get rid of nucleases, use that.
118. Elute in DNA in 50 µL of the kit elution buffer.

E. coli transformations, one per group

This protocol is described in greater detail here.

119. Add the 10 µL of the plasmid DNA to the tube with competent cells, flick the tube a few times to mix. Do NOT vortex the cells at this point.
120. Incubate for 20-30 min on ice.
121. Heat shock in water bath at 42°C during EXACTLY 45s.
122. Cool the tube for 2 min in a water/ice slurry for fast heat transfer.
123. Add 1 mL pre-warmed liquid LB medium to one and let cells recover at 37°C for 30 min - 1 h.
124. Centrifuge cells for 30 s.
125. Take out 1 mL medium and discard.
126. Resuspend cells in the remaining liquid (200-300 µL).
127. Plate by adding 10-20 sterile glass beads to an LB ampicillin and swirl the plate to spread the liquid.
128. Incubate inverted at 37°C for 12-24 hours.

LAB 9️⃣ PL2 Miniprep#2 ➕ Gel#4

material#LAB8

Summary:

• Plasmid miniprep
• Load & run agarose gel#4 on plasmid preparations.

Miniprep (One per student)

Preparation of 16 plasmids (One per student) using alkaline lysis mini prep. We will use the a alkaline lysis plasmid miniprep protocol. The teacher has prepared E. coli cultures in liquid or on solid medium beforehand. Cultures with each plasmid were grown in or on LB with ampicillin for selection of the plasmids. Here is a short protocol for printing.

Agarose gel electrophoresis of plasmid DNA

129. Add 10 µL 6 x loading buffer to your plasmid DNA.
130. If necessary, spin the tube for ~2-3 seconds to collect the liquid at the bottom.
131. Put the gel in the gel tray.
132. Add more buffer (if needed) until the gel is just submerged.
133. Add 8 µL of the plasmid DNA to an empty well, start with the leftmost well.
134. All group members should load their plasmid.
135. Take note of where your samples are.
136. The teacher will help you to put the gel in the electrophoresis chamber.
137. The teacher will load the molecular weight marker.
138. Apply the electrical field as soon as you are done.
139. The electrophoresis last around 15 - 20 min in the Bachman gel unit powered by the homemade rectifier.
140. When the gel run is completed, the teacher with take a picture using a transilluminator.

LAB 🔟 OPTIONAL! restriction digestion ➕ gel#5)

material#LAB9

Summary:

• cut DNA with restriction enzymes
• run agarose gel#5

Table#6	Group	Enzyme	Buffer
	1
	2
	3
	4

Restriction digestion (One per group)

141. Unfreeze the plasmid solution.
142. Pipette 8 µL of the plasmid solution into a new Eppendorf tube.
143. Mark the Eppendorf tube
144. Ask your teacher to add 1 µL of Restriction enzyme buffer and 1 µL enzyme (Table#6) to your tube.
145. Spin and incubate for one hour at 37°C. Continue to assemble the plasmid in-silico.
146. Add 2 µL DNA loading buffer to your tube
147. Load all of the tube content on an agarose gel